| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.172967 |
| Chromosome: | chromosome 3 |
| Location: | 6200212 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g192350 | (1 of 2) IPR006652//IPR015915 - Kelch repeat type 1 // Kelch-type beta propeller | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTACTGAAGAACTGTTTGCAAGGTGGGGT |
| Internal bar code: | GATAAAGTCGGGGAAACGCGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1032 |
| LEAP-Seq percent confirming: | 95.5556 |
| LEAP-Seq n confirming: | 129 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGAGCATGCTTCGGAACT |
| Suggested primer 2: | CCCTGCTCTACCTACCCTCC |