Insertion junction: LMJ.RY0402.172992_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.172992
Chromosome:chromosome_16
Location:3874412
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g690100 FAP213 Flagellar Associated Protein antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):CTCGTCGCAGAAGGCTGGGGCATTCCGTGC
Internal bar code:GTCATAGCTTCCTGTGTGGCGG

Confirmation - LEAP-Seq

LEAP-Seq distance:804
LEAP-Seq percent confirming:99.0768
LEAP-Seq n confirming:7083
LEAP-Seq n nonconfirming:66
LEAP-Seq n unique pos:40

Suggested primers for confirmation by PCR

Suggested primer 1:CGTCAGATGAGAGTGTCGGA
Suggested primer 2:CTGGTGTAGGACCCGACATT