| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.173018 |
| Chromosome: | chromosome 8 |
| Location: | 308213 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358564 | FAP344 | Flagellar Associated Protein 344; (1 of 6) PF06985 - Heterokaryon incompatibility protein (HET) (HET) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCACCACTGGCGCAAGCAACACATACACC |
| Internal bar code: | CCGGGCTTTCTTGAAAAACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 179 |
| LEAP-Seq percent confirming: | 99.5496 |
| LEAP-Seq n confirming: | 442 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAGTCAGCATCAAGTCAA |
| Suggested primer 2: | AGAAGATGGGGCACATCAAG |