| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.173140 |
| Chromosome: | chromosome 3 |
| Location: | 5145279 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182050 | LCS1 | (1 of 4) K01897 - long-chain acyl-CoA synthetase (ACSL, fadD); Long-chain acyl-CoA synthetase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTGCGGTTGTAGGCCCAGTTGAAGATA |
| Internal bar code: | GCCAAAGGTGAAGCTAATGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1063 |
| LEAP-Seq percent confirming: | 99.7856 |
| LEAP-Seq n confirming: | 5585 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACTACACACAGCACCACCC |
| Suggested primer 2: | TGTTGCCTTGTCAACCATGT |