Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.173179 |
Chromosome: | chromosome 1 |
Location: | 4143744 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g027350 | TMG10 | (1 of 2) PTHR12029:SF11 - METHYLTRANSFERASE TARBP1-RELATED; tRNA (guanosine-2'-O)-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGAATGGACATCCCCGCGCTCCCGCCCC |
Internal bar code: | TTACCACCGTCACTGCGAGCGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 461 |
LEAP-Seq percent confirming: | 97.2222 |
LEAP-Seq n confirming: | 770 |
LEAP-Seq n nonconfirming: | 22 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGCACATAGTCGTACAGC |
Suggested primer 2: | CTGTTGGTTGCTTCCCTCAT |