| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.173208 |
| Chromosome: | chromosome 3 |
| Location: | 4673971 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g177600 | (1 of 1) 1.1.3.8 - L-gulonolactone oxidase / L-gulono-gamma-lactone oxidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGCCATCACGATGTCCGCCACCTCCTC |
| Internal bar code: | CAGGGTCGGGTAACGCCGATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 234 |
| LEAP-Seq percent confirming: | 70.7531 |
| LEAP-Seq n confirming: | 808 |
| LEAP-Seq n nonconfirming: | 334 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATGTCGTACTCCAGCAGC |
| Suggested primer 2: | TAGCTCGCATATCAACGCAC |