| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.173364 |
| Chromosome: | chromosome 10 |
| Location: | 1513257 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g428900 | RRM9,CGL72 | (1 of 1) 2.1.1.226 - 23S rRNA (cytidine(1920)-2'-O)-methyltransferase; Conserved in the Green Lineage | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTACAAGTTGCTAGCGCGTCTGCCAACGG |
| Internal bar code: | CTGATTTTCCTTGGATATGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 497 |
| LEAP-Seq percent confirming: | 99.4697 |
| LEAP-Seq n confirming: | 6378 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTTCTCCATCACCACGACC |
| Suggested primer 2: | TCATCCTACAGGGCAAGGTC |