| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.173441 |
| Chromosome: | chromosome 10 |
| Location: | 3363124 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g444000 | (1 of 2) IPR007743//IPR027417//IPR030385 - Immunity-related GTPases-like // P-loop containing nucleoside triphosphate hydrolase // IRG-type guanine nucleotide-binding (G) domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCAGAACGCGCACCAGACCGCACCCCATGG |
| Internal bar code: | GATCCCAATTGTGCCGCTGAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 476 |
| LEAP-Seq percent confirming: | 99.2438 |
| LEAP-Seq n confirming: | 3281 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGAGCAGTTGGGACAGTG |
| Suggested primer 2: | GAATCTGGCATGGGACTGTT |