Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.173448 |
Chromosome: | chromosome 16 |
Location: | 2411459 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g660350 | (1 of 1) K15363 - fanconi-associated nuclease 1 (FAN1, MTMR15) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGGCCCACTGTGCCCCGCAAGACTTTGC |
Internal bar code: | AAGCGGGGATGGGGGCGTCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 480 |
LEAP-Seq percent confirming: | 99.8922 |
LEAP-Seq n confirming: | 927 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCGTTTTGGAAGAAGAAACG |
Suggested primer 2: | CACTTCCCACCTGAACACCT |