Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.173489 |
Chromosome: | chromosome 10 |
Location: | 3062877 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g441500 | (1 of 1) K09602 - ubiquitin thioesterase protein OTUB1 [EC:3.4.19.12] (OTUB1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCGAGCGCTTCGGTTTGCCGGTTGGGAG |
Internal bar code: | CAGTGGGTGAAGAGCCTTGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 774 |
LEAP-Seq percent confirming: | 99.884 |
LEAP-Seq n confirming: | 2583 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACACACCATCACTTCCAC |
Suggested primer 2: | GGGACGCATTATCACAGCTT |