| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.173640 |
| Chromosome: | chromosome 12 |
| Location: | 4251167 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g519180 | EFT1a,PSRP7,EFT1 | Chloroplast elongation factor Ts-like protein; (1 of 1) K02357 - elongation factor Ts (tsf, TSFM) | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAGCAAGGTGTGGTCCGGCGGAGAGACC |
| Internal bar code: | CCGCCGAAGGTCACGAAAGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 635 |
| LEAP-Seq percent confirming: | 99.264 |
| LEAP-Seq n confirming: | 2023 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACTGCTTGACCTTGCATC |
| Suggested primer 2: | GACCGCTTTTCTCTTTGACG |