Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.173647 |
Chromosome: | chromosome 12 |
Location: | 3908411 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g515950 | (1 of 35) IPR001763 - Rhodanese-like domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTAGCTGGGGCCTGCTGGGGTCTTAAAA |
Internal bar code: | GCGTCGCGAACCGGTCGAGCCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1138 |
LEAP-Seq percent confirming: | 99.1174 |
LEAP-Seq n confirming: | 7524 |
LEAP-Seq n nonconfirming: | 67 |
LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTACTTGCGGCACAAGCTG |
Suggested primer 2: | CAGTGGTTGGGGCTTGTAGT |