| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.173679 |
| Chromosome: | chromosome 8 |
| Location: | 80410 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g358525 | GPX2,PHGPx2 | (1 of 1) 1.11.1.12//1.11.1.9 - Phospholipid-hydroperoxide glutathione peroxidase / Peroxidation-inhibiting protein // Glutathione peroxidase; Glutathione peroxidase 2, selenoprotein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAGCCCTGCACCCGACCCGAACGGAGGC |
| Internal bar code: | TCGTTAGGTCTTGTATGGGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 918 |
| LEAP-Seq percent confirming: | 86.1785 |
| LEAP-Seq n confirming: | 2201 |
| LEAP-Seq n nonconfirming: | 353 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGCAGTGAACGTGAGCA |
| Suggested primer 2: | GAGCAGGCCAGGGTACAATA |