| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.173734 |
| Chromosome: | chromosome 9 |
| Location: | 4628999 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396624 | (1 of 1) IPR000104//IPR001841//IPR002110//IPR016024//IPR020683 - Antifreeze protein, type I // Zinc finger, RING-type // Ankyrin repeat // Armadillo-type fold // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCATCCCCCCCATCTCCGTTGTGCGTGGG |
| Internal bar code: | GGCTAGGCCTTAGCGAGCGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 845 |
| LEAP-Seq percent confirming: | 62.2951 |
| LEAP-Seq n confirming: | 494 |
| LEAP-Seq n nonconfirming: | 299 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACTGCTGAGGAGGAGGCA |
| Suggested primer 2: | GGGCTCCTTTAAACTTTCCG |