Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.173734 |
Chromosome: | chromosome 10 |
Location: | 2948054 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g440500 | (1 of 5) PF12738 - twin BRCT domain (PTCB-BRCT) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCACACGCAGAGTCTCGCCTTGAAAGGTG |
Internal bar code: | TAAATCGCAGTCGGGATGTTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1174 |
LEAP-Seq percent confirming: | 99.4493 |
LEAP-Seq n confirming: | 3431 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGTGATACAGAGGACCAGG |
Suggested primer 2: | GAGGCTCAGAAATGTCGCTG |