| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.173738 |
| Chromosome: | chromosome 16 |
| Location: | 2078462 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g657450 | MPA12 | Metallophosphoesterase/metallo-dependent phosphatase; (1 of 1) 3.6.1.13//3.6.1.16//3.6.1.53 - ADP-ribose diphosphatase / ADPR-PPase // CDP-glycerol diphosphatase / CDP-glycerol pyrophosphatase // Mn(2+)-dependent ADP-ribose/CDP-alcohol diphosphatase / Mn(2+)-dependent ADP-ribose/CDP-alcohol pyrophosphatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGTCCTGTATGACTCTCCACCTTGGACC |
| Internal bar code: | GGGCGAGGCCGGAATCGGGTATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3 |
| LEAP-Seq percent confirming: | 91.7105 |
| LEAP-Seq n confirming: | 697 |
| LEAP-Seq n nonconfirming: | 63 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTAAATTGACTGGCTTGGGG |
| Suggested primer 2: | ACGGAGGGAGAGGAGTCATT |