Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.173881 |
Chromosome: | chromosome 14 |
Location: | 1685316 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g619300 | CYN16 | Cyclophilin 16; (1 of 60) 5.2.1.8 - Peptidylprolyl isomerase / Rotamase | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCTTAACCTCAGAACCCATGTATTTTAT |
Internal bar code: | TTGACTCGAATTGGTCGATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1146 |
LEAP-Seq percent confirming: | 99.2879 |
LEAP-Seq n confirming: | 5298 |
LEAP-Seq n nonconfirming: | 38 |
LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCGTTATGCGTAGGATTGC |
Suggested primer 2: | CACCTGGTGCGATATACGTG |