| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.173898 |
| Chromosome: | chromosome 12 |
| Location: | 2133119 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g508900 | MAPK6 | (1 of 3) K04371 - mitogen-activated protein kinase 1/3 (MAPK1_3); Mitogen-Activated Protein Kinase 6 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAAAAATGGCTCAAGCACCACAGGCAGG |
| Internal bar code: | CCGACTACATCGGGTCGATAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1018 |
| LEAP-Seq percent confirming: | 99.8031 |
| LEAP-Seq n confirming: | 507 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAAGTGCTCGTTTGTGAG |
| Suggested primer 2: | GGCTGAGTCAGGCTGGTTAG |