Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.173969 |
Chromosome: | chromosome 8 |
Location: | 2326605 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g370601 | (1 of 1) K14559 - U3 small nucleolar RNA-associated protein MPP10 (MPP10) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAAGGTGCTGTGTGTGTTCGGTGATGTGT |
Internal bar code: | CATTTCACGACTCACAATTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 370 |
LEAP-Seq percent confirming: | 99.7859 |
LEAP-Seq n confirming: | 466 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAAAGCAGAGGAAGACCTG |
Suggested primer 2: | ACCCCACTTCTACTTGGCCT |