| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.173999 |
| Chromosome: | chromosome 1 |
| Location: | 4195848 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g027800 | ATPVH1,ATPvH | (1 of 1) K02144 - V-type H+-transporting ATPase subunit H (ATPeV1H); Vacuolar ATP synthase subunit H | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGTGGCCAACCGGTCCTGCTGGCGTGC |
| Internal bar code: | GTAACGCAAAACTACCCAAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1188 |
| LEAP-Seq percent confirming: | 99.7717 |
| LEAP-Seq n confirming: | 1311 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCAGGAACAGGCTGATGT |
| Suggested primer 2: | CTTTTCTCCAGCAAGCCATC |