| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.174038 |
| Chromosome: | chromosome 1 |
| Location: | 5558695 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039500 | FAP89 | Flagellar Associated Protein 89; (1 of 3) PTHR22847:SF361 - JOUBERIN | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCTCGGGCTGCGCCGCCGCCACGTCCC |
| Internal bar code: | GTTCGGCTGTTTTGGCGTTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 693 |
| LEAP-Seq percent confirming: | 99.5695 |
| LEAP-Seq n confirming: | 1619 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAATGTGTTGAGTGGTCG |
| Suggested primer 2: | CTTGCAGTCAAACGGAAGGT |