Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.174074 |
Chromosome: | chromosome 9 |
Location: | 1985444 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g394700 | RNZ1 | (1 of 6) 3.1.26.11 - Ribonuclease Z / tRNase Z; Ribonuclease Z | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTGGCATGGGTTAGGCGCGGCTAGCAGC |
Internal bar code: | GGGGTCTGATCAACAAAAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 545 |
LEAP-Seq percent confirming: | 80.563 |
LEAP-Seq n confirming: | 1803 |
LEAP-Seq n nonconfirming: | 435 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATATGGGCGTATGTAGGGG |
Suggested primer 2: | TATTCCGCATTTTCCTCACC |