| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.174093 |
| Chromosome: | chromosome 12 |
| Location: | 5316610 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g529150 | PPP40,PP2C1,FAP314 | Flagellar Associated Protein 314; (1 of 1) PTHR13832:SF352 - PROTEIN PHOSPHATASE 2C 59-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGCCACGGTGGTTCGCCGCACGGACTGC |
| Internal bar code: | GTCATACCCCCGGGACCCGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 513 |
| LEAP-Seq percent confirming: | 99.4725 |
| LEAP-Seq n confirming: | 7355 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCGAGGCTGCATTCTAGT |
| Suggested primer 2: | TGTCTTGCAGGTACGTTTGC |