| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.174102 |
| Chromosome: | chromosome 10 |
| Location: | 5095532 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456100 | FAP142,POC21,AGG3 | (1 of 4) K03809 - NAD(P)H dehydrogenase (quinone) (wrbA); Aggregation 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAAGTAGCCCACACAACGACAACACCAGA |
| Internal bar code: | GTGGTCACAAGATCCGCACCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 932 |
| LEAP-Seq percent confirming: | 20.2128 |
| LEAP-Seq n confirming: | 133 |
| LEAP-Seq n nonconfirming: | 525 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCCGTCCACTCTGTCATT |
| Suggested primer 2: | ACCCGTGTGATGCTGTCATA |