| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.174105 |
| Chromosome: | chromosome 17 |
| Location: | 5730980 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g739050 | (1 of 230) IPR017986 - WD40-repeat-containing domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGATGGGCGGGCTGGCGGCGGCGGCGGCA |
| Internal bar code: | GGCCGTATGCCGTAGCCATTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 441 |
| LEAP-Seq percent confirming: | 7.78634 |
| LEAP-Seq n confirming: | 1293 |
| LEAP-Seq n nonconfirming: | 15313 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACGCAC |
| Suggested primer 2: | CTGCTGAGGGTGCTGCTACT |