| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.174118 |
| Chromosome: | chromosome 3 |
| Location: | 4419860 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g175650 | (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCTGTTGAGCCACAGAGGCTTTAATTCA |
| Internal bar code: | GCGATGAGAGCAGCAATCGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 750 |
| LEAP-Seq percent confirming: | 99.5098 |
| LEAP-Seq n confirming: | 1218 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGACGTCGACCTTTTGAC |
| Suggested primer 2: | GTAGCCACATGCAAGCAAGA |