Insertion junction: LMJ.RY0402.174176_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.174176
Chromosome:chromosome_12
Location:3577181
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g513650 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CATTTTAAGACGAATTGAGACACTGGGTAT
Internal bar code:GGAACAACTGGTCAACTACTCG

Confirmation - LEAP-Seq

LEAP-Seq distance:570
LEAP-Seq percent confirming:99.8782
LEAP-Seq n confirming:3279
LEAP-Seq n nonconfirming:4
LEAP-Seq n unique pos:19

Suggested primers for confirmation by PCR

Suggested primer 1:TTTAGATGACCGTTGGAGCC
Suggested primer 2:AAGCAAAAGGACTGGAGCAA