Insertion junction: LMJ.RY0402.174176_2

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.174176
Chromosome:chromosome_12
Location:3577182
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre12.g513650 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCCGCGCATCCAGCTCCACCGTGGCAGTA
Internal bar code:GCAACGACGGTAATGCTGGCTT

Confirmation - LEAP-Seq

LEAP-Seq distance:93
LEAP-Seq percent confirming:100.0
LEAP-Seq n confirming:30
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:TTTAGATGACCGTTGGAGCC
Suggested primer 2:AAGCAAAAGGACTGGAGCAA