| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.174222 |
| Chromosome: | chromosome 10 |
| Location: | 4089709 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g449700 | (1 of 7) PF00582 - Universal stress protein family (Usp) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCTTGCCGGCGCGCAGGTCCTTCATGAC |
| Internal bar code: | CCCACGGCTCCGTAGCGGTTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 689 |
| LEAP-Seq percent confirming: | 99.8002 |
| LEAP-Seq n confirming: | 999 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCGCTCGGTGAATATATCG |
| Suggested primer 2: | CAATCTGAGGTGCCTGGTTT |