| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.174244 |
| Chromosome: | chromosome 3 |
| Location: | 2510351 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g159851 | (1 of 2) IPR001623//IPR002110//IPR020683 - DnaJ domain // Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCCCATGTACCGTACACAGGCATCCCG |
| Internal bar code: | GGCAATCGAACGGAGGCGGGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1165 |
| LEAP-Seq percent confirming: | 91.8551 |
| LEAP-Seq n confirming: | 6135 |
| LEAP-Seq n nonconfirming: | 544 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGATGGACCATTGCACACT |
| Suggested primer 2: | CAGGAGCTTGTGTCGCATTA |