| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.174264 |
| Chromosome: | chromosome 1 |
| Location: | 1404199 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g007000 | (1 of 4) 3.6.3.29 - Molybdate-transporting ATPase; ABC transporter, half | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAAGGGGGGGCAGGGAATAGGGAGGGCG |
| Internal bar code: | CCGTGGTGGGATGCCCCGCAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 580 |
| LEAP-Seq percent confirming: | 99.8741 |
| LEAP-Seq n confirming: | 793 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCAAGTGCGTATCGTGCTTC |
| Suggested primer 2: | TACCAGCCCAAACTAAACCG |