| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.174278 |
| Chromosome: | chromosome 17 |
| Location: | 2078704 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g712100 | MDAR1,PNO2 | Monodehydroascorbate reductase 1; (1 of 1) K08232 - monodehydroascorbate reductase (NADH) (E1.6.5.4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTTTAGTGTGCAGGGCGAGTCGGGTAAT |
| Internal bar code: | ATATCTACGGCCGGTACCGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 737 |
| LEAP-Seq percent confirming: | 99.7658 |
| LEAP-Seq n confirming: | 426 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTGTTAGGGAAGGGTTGC |
| Suggested primer 2: | GACGCTAAACCTCCTACCCC |