| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.174362 |
| Chromosome: | chromosome 12 |
| Location: | 223147 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g485050 | CAH6 | Carbonic Anhydrase 6; (1 of 3) PTHR11002//PTHR11002:SF17 - CARBONIC ANHYDRASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCGCGGCTTGAGTTCTTGACATGTATC |
| Internal bar code: | GCGACCGCCCTCCGCCCCGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 360 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 164 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGACCAGTTCGCAAAAAT |
| Suggested primer 2: | GCACGAAAGATGTCTACGCA |