Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.174393 |
Chromosome: | chromosome 6 |
Location: | 1798949 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g262400 | (1 of 1) K14676 - lysophospholipid hydrolase (NTE, NRE) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTAGGCACTGGAGGCGGGGCCAGCGTCC |
Internal bar code: | GAAGGCGACAGCCACACAGAAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1038 |
LEAP-Seq percent confirming: | 99.7314 |
LEAP-Seq n confirming: | 1485 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCTGGTGCTGATACTGCTG |
Suggested primer 2: | TCGTACTGCAGCAAATGGAG |