| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.174498 |
| Chromosome: | chromosome 3 |
| Location: | 4529030 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176550 | PRMT5,PRM5 | (1 of 1) K02516 - protein arginine N-methyltransferase 5 (PRMT5, HSL7); Protein-/Histone-arginine N-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTACTGTACTAACTTTCGGCCCACCCTC |
| Internal bar code: | TTCGCGTCGAGGATGTCCAACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 463 |
| LEAP-Seq percent confirming: | 53.5552 |
| LEAP-Seq n confirming: | 354 |
| LEAP-Seq n nonconfirming: | 307 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCAGGTAGTCCCGGTAAC |
| Suggested primer 2: | CCGTGTGTGTGTGTGTGTGT |