| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.174563 |
| Chromosome: | chromosome 11 |
| Location: | 558254 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467607 | (1 of 3) 2.7.11.17//2.7.11.25 - Calcium/calmodulin-dependent protein kinase / Microtubule-associated protein 2 kinase // Mitogen-activated protein kinase kinase kinase / MLTK | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGAGGGCGGGCTCGGACATCACGACCAC |
| Internal bar code: | CATACTTGTCGCGCACCGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 408 |
| LEAP-Seq percent confirming: | 99.6807 |
| LEAP-Seq n confirming: | 1873 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGAGGTCAGTTAGGCCAG |
| Suggested primer 2: | CCTAGGGTTTGGGTTCCAAT |