Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.174579 |
Chromosome: | chromosome 2 |
Location: | 1524558 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g084400 | P4H9,PFH9,PHX4 | (1 of 8) PTHR10869//PTHR10869:SF71 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // SUBFAMILY NOT NAMED; Prolyl 4-hydroxylase 9 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACAACACCCTCGCCATCATTGCCCACG |
Internal bar code: | TTGCCGGTTCACGCCTGCGAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 973 |
LEAP-Seq percent confirming: | 99.5783 |
LEAP-Seq n confirming: | 4723 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGCAGCCTTTCCTACAAG |
Suggested primer 2: | TCCCCACCTTGTCGTACTTC |