| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.174586 |
| Chromosome: | chromosome 2 |
| Location: | 529293 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g077150 | CPLD14 | Conserved in the Plant Lineage and Diatoms; (1 of 2) PF05684 - Protein of unknown function (DUF819) (DUF819) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGAGTCCCAGAGTGCGTGTCGATACAGA |
| Internal bar code: | CCCGCATGGACCAGCGAGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 707 |
| LEAP-Seq percent confirming: | 48.6833 |
| LEAP-Seq n confirming: | 4400 |
| LEAP-Seq n nonconfirming: | 4638 |
| LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTATGCCCGTGCCGTACTAT |
| Suggested primer 2: | GGTTGTGATACCAGCGAGGT |