| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.174640 |
| Chromosome: | chromosome 3 |
| Location: | 6746821 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g198050 | (1 of 2) IPR002913//IPR023393 - START domain // START-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACCTGCCTGGCATCGCACCCTCGGAATC |
| Internal bar code: | AAGCGGTTGGTACAGTTCGCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1262 |
| LEAP-Seq percent confirming: | 99.2945 |
| LEAP-Seq n confirming: | 5489 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGACCCAGTACACACCTGCC |
| Suggested primer 2: | CTTTGAGCCAGGTAAGCGTC |