| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.174668 |
| Chromosome: | chromosome 12 |
| Location: | 5261935 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g528450 | ASO1,LASPO1 | L-aspartate oxidase; (1 of 1) 1.4.3.16 - L-aspartate oxidase / LASPO | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAACACGCACGAGTGCCTCTGCTACCAC |
| Internal bar code: | AACGGTCGCGTTCCGGATAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 912 |
| LEAP-Seq percent confirming: | 98.4707 |
| LEAP-Seq n confirming: | 1159 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGATAGGGTATGGGGCAAGT |
| Suggested primer 2: | GTATGCTTGGACTGACCCGT |