Insertion junction: LMJ.RY0402.174785_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.174785
Chromosome:chromosome_17
Location:5462180
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre17.g737200 sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GGAGGCTGTGGTCGAGCTTTGAGGGGTACG
Internal bar code:CCGGGCGTCAGCGGTGGTGGGA

Confirmation - LEAP-Seq

LEAP-Seq distance:430
LEAP-Seq percent confirming:98.8506
LEAP-Seq n confirming:86
LEAP-Seq n nonconfirming:1
LEAP-Seq n unique pos:2

Suggested primers for confirmation by PCR

Suggested primer 1:GAACTATGGTCAGGGCGTGT
Suggested primer 2:GTAATGGGAGCACAGTCCGT