| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.174835 |
| Chromosome: | chromosome 2 |
| Location: | 5664451 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g109683 | (1 of 3) IPR002912//IPR011598 - ACT domain // Myc-type, basic helix-loop-helix (bHLH) domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTGCTGTGTGCCGTGATGTACAAGTGCT |
| Internal bar code: | GATGGTAGGGCATGCAGGTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 518 |
| LEAP-Seq percent confirming: | 86.3474 |
| LEAP-Seq n confirming: | 1208 |
| LEAP-Seq n nonconfirming: | 191 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGAACTGCCGTTTCCTGA |
| Suggested primer 2: | TACCACCAAGGCTTACAGGG |