| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.174854 |
| Chromosome: | chromosome 2 |
| Location: | 5175196 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g105500 | AOD1 | Acetylornithine deacetylase; (1 of 1) 3.5.1.16 - Acetylornithine deacetylase / N-acetylornithinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGCCCGGCCTTGAGGTTGTCCAGCTCGC |
| Internal bar code: | GCGGAGCTGGAAACGACTGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 705 |
| LEAP-Seq percent confirming: | 97.8941 |
| LEAP-Seq n confirming: | 1627 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTGGAACATCTTGCCCTT |
| Suggested primer 2: | CATGCGGAATGAATGATACG |