| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.174902 |
| Chromosome: | chromosome 1 |
| Location: | 5150560 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g035850 | SEC24B | (1 of 1) PTHR13803//PTHR13803:SF4 - SEC24-RELATED PROTEIN // SEC24; COP-II coat subunit | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCACCCCCTATGGCAGGAATATAACTT |
| Internal bar code: | GAATAAAGCGCCATATGATTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 444 |
| LEAP-Seq percent confirming: | 98.6799 |
| LEAP-Seq n confirming: | 1495 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCATACGCTATCCCAAAGC |
| Suggested primer 2: | CCAGGTAGCTGAGCTTGTCC |