Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.174916 |
Chromosome: | chromosome 10 |
Location: | 3124016 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g441800 | (1 of 4) PF05066 - HB1, ASXL, restriction endonuclease HTH domain (HARE-HTH) | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCTCGGTTCAGACATCGAGGGGCCCACA |
Internal bar code: | CCCTCTGTCCAGGTGGGCAAAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 907 |
LEAP-Seq percent confirming: | 94.3858 |
LEAP-Seq n confirming: | 1698 |
LEAP-Seq n nonconfirming: | 101 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGGTAGCCTCTGGGGTCTT |
Suggested primer 2: | GCCAAAGAGTCCAAGCAGAC |