Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.174923 |
Chromosome: | chromosome 4 |
Location: | 1706009 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g212650 | (1 of 1) PTHR21231//PTHR21231:SF7 - XPA-BINDING PROTEIN 1-RELATED // GPN-LOOP GTPASE 3 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTCTTACGGTTTGGTTCTAGTAACCCCC |
Internal bar code: | TCCAAGTCTGTGGGCCCCGGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1009 |
LEAP-Seq percent confirming: | 99.8989 |
LEAP-Seq n confirming: | 988 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGGATACAAGCAGGTGGG |
Suggested primer 2: | CTGAAACACACCCGAAACCT |