| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.175176 |
| Chromosome: | chromosome 16 |
| Location: | 4967480 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685300 | (1 of 8) 2.3.1.75 - Long-chain-alcohol O-fatty-acyltransferase / Wax synthase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATAGGGTTTGGCACGCGGCTGAGGGAGT |
| Internal bar code: | ATGCGTCTGGTCATAGCATCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 896 |
| LEAP-Seq percent confirming: | 97.8775 |
| LEAP-Seq n confirming: | 1199 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACTCACACTCCAGGCAAG |
| Suggested primer 2: | GAAGACTAGGCAGCCGAATG |