| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.175264 |
| Chromosome: | chromosome 6 |
| Location: | 1567025 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260400 | FAP287 | (1 of 1) PF13881 - Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD_2); Ubiquitin-like Flagellar Associated Protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATAAGATGCAGACGTATCCAGTGTGCTAC |
| Internal bar code: | GCTACGTTACCCTAGCGGCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 452 |
| LEAP-Seq percent confirming: | 98.446 |
| LEAP-Seq n confirming: | 4878 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCTACTGCGGAAACGCTC |
| Suggested primer 2: | AGCTTAAAGGTGAGTGGCGA |