| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.175271 |
| Chromosome: | chromosome 3 |
| Location: | 111985 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g143987 | (1 of 1) IPR011016//IPR014048 - Zinc finger, RING-CH-type // Methylated-DNA-[protein]-cysteine S-methyltransferase, DNA binding | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAAACGGGACCCGTACGACAGCGCACAGG |
| Internal bar code: | GTTCCGGCAGTTCCTTCGTAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 790 |
| LEAP-Seq percent confirming: | 99.5385 |
| LEAP-Seq n confirming: | 1294 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCCTAAACGTATCGTGGAT |
| Suggested primer 2: | AGTTCCTGTGGTGTTCAGGG |