Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.175281 |
Chromosome: | chromosome 7 |
Location: | 4198333 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g342200 | Dyf-1Fleer,FAP259,IFT70,CrDYF-1,Ttc30 | Intraflagellar Transport Protein 70; (1 of 2) PF13414//PF14559 - TPR repeat (TPR_11) // Tetratricopeptide repeat (TPR_19) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACGGTGGAAGCACGCCGCCACTGCTGCG |
Internal bar code: | GAGTGGTCAAAGCGTCCTGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 568 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 199 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGCCTCAAAACCACTCTC |
Suggested primer 2: | AGATCATTGAAAAGGCCGTG |